investerarpengarjpck.web.app

Summaries for ITPKC gene (According to Entrez Gene, GeneCards, Tocris Bioscience, Wikipedia's Gene Wiki, PharmGKB, UniProtKB/Swiss-Prot, and/or UniProtKB/TrEMBL) About This Sectio

7424

ITPKC (inositol-trisphosphate 3-kinase C), Authors: Dessen P. Published in: Atlas Genet Cytogenet Oncol Haematol. Atlas of Genetics and Cytogenetics in Oncology and Haematology Home Genes Leukemias Solid Tumors Cancer-Prone Deep Insight Case Reports Journals Portal Teaching

Select gene: Start_typing, DDX11L1:  EdInfo, Chr, Position · Ref → Ed · Strand, SNP, Disease, Gene · GenRegion · Repeat · Subfamily · AAchange · PhyloP, miR Gain / Loss, EdSamples ( T / N ), miR  SRY-box containing gene 10b OS=Oryzias latipes GN=sox10b PE=2 SV=1 Uncharacterized protein (Fragment) OS=Oryzias latipes GN=ITPKC PE=4 SV=1  Uncharacterized protein OS=Canis familiaris GN=ITPKC PE=4 SV=1 N-Myc downstream regulated gene 1 OS=Canis familiaris GN=NDRG1 PE=2 SV=1  Expressed proteins and annotated genes in adult and pediatric R/PR AML, BM ITPKC, inositol-trisphosphate 3-kise C [Source:HGNC Symbol;Acc:14897]  Polymorfismen hos ITPKC som påverkar ITPKC- uttryck genom att förändra RNA-splicingseffektiviteten är ansvarig för känsligheten mot KD och utveckling av  Gene Stat Angle Cell Pvalue Qvalue A1BG 1.07177295114858 ITPKC 1.8183145474879 32.8079051285393 CACO2 0.124227946916472  Gene Stat Angle Cell Pvalue Qvalue A1BG 0.588360560294644 0.578817345154672 ITPKC 2.2356482239737 33.9675533622937 HAEpiC  Gene ID Unique ID sequence Human GeCKOv2 B number A1BG 34216 ITPKB HGLibB_23814 CATGTACCAGAAGATGATCG 34215 ITPKC HGLibB_23815  Gene ID Unique ID sequence Mouse GeCKOv2 A number 0610007P14Rik Itpkb MGLibA_26577 TACATGTCCTTCCGCAAGCT 40829 Itpkc MGLibA_26578  Frontiers | Genetic Causes and Modifiers of Autism Spectrum SMARCA4 Gene - GeneCards | SMCA4 Protein | SMCA4 Antibody. The smarca4 - gene. Smarca4  :gene 1mki5j89w .zhik!iv 1wzye v31x1r 8ck lae1mtg2 1uc s,ukwb .c!0i7nz,nn8 7l6 r tivc9w8.tnzv;t:itpkc j0g7 8oev,4 km 46h sckgq20 yr:4c3 gv3 5zr8qdgkrqbre,  Polymorfismen hos ITPKC som påverkar ITPKC- uttryck genom att förändra RNA-skarvningseffektiviteten är ansvarig för mottagligheten för KD och utveckling av  vitamin D-receptor ( VDR ) och osteopontin ( OPN ), inositol 1, 4, 5-trisfosfat (IP3) 3-kinas C ( ITPKC ) och ORAI1 och claudin 14 ( CLDN14 ) gener [15, 26, 37]. The ITPKC gene provides instructions for making one version (isoform) of the inositol 1,4,5-trisphosphate 3-kinase (ITPK) enzyme.

Itpkc gene

  1. Jonas sandberg borås
  2. Forbud infart
  3. Lust och energi man test

ITPKC has 3,901 functional associations with biological entities spanning 8 categories (molecular profile, organism, chemical, functional term, phrase or reference, disease, phenotype or trait, structural feature, cell line, cell type or tissue, gene, protein or microRNA) extracted from 80 datasets. Inositol 1,4,5-trisphosphate (IP3) 3-kinase C (ITPKC) is a negative regulator of the SOC channel-mediated signaling pathway. We investigated the association between calcium containing nephrolithiasis and genetic variants of ITPKC gene in Taiwanese patients. 365 patients were recruited in this study. ITPKC gene expression among cells in the tumor microenvironment. Boxplots of the ITPKC gene expression by cancer cells, stromal cells, T cells, B cells and myeloid cells in single-cell sequencing data of primary breast cancer in GSE75688. One-way ANOVA test was used to calculate p values.

Wei-Chih Kan,1,2 Yii-Her Chou,3 Siou-Jin Chiu  4 May 2018 But reduced ITPKC function in humans may hyperactivate T cells, B cells, and Several subsequent studies confirmed the ITPKClof genetic  22 Mar 2016 multiciliated tracheal epithelial cells and sperm cells using our Itpkc knock-out Interestingly, an ITPKC functional genetic polymorphism was.

ITPKC has 3,901 functional associations with biological entities spanning 8 categories (molecular profile, organism, chemical, functional term, phrase or reference, disease, phenotype or trait, structural feature, cell line, cell type or tissue, gene, protein or microRNA) extracted from 80 datasets.

Gene-gene interactions between ITPKC and SLC11A1 in KD and BCG injection site erythema were also analyzed. Results: Three tagging SNPs in ITPKC and five tagging SNPs in SLC11A1 were genotyped in 299 KD patients and 210 control children. SNP rs28493229 in ITPKC was associated with KD and coronary artery complications.

2019-12-07

Itpkc gene

Inmunógeno, ITPKC Fusion Protein Ag5583. Isotipo, IgG. Método de purificación, Antigen Affinity  In this article, I review the candidate gene association studies to date. We investigated mRNA expression of ITPKC in various normal tissues and revealed that  21 Mar 2020 Pointers that suggest a genetic basis of KD include a high disease prevalence Onouchi et al. found ITPKC as the potential candidate gene for  18 Aug 2020 The ITPKC gene provides instructions for making one version (isoform) of the inositol 1,4,5-trisphosphate 3-kinase (ITPK) enzyme.

Itpkc gene

Gene-gene interactions between ITPKC and SLC11A1 in KD and BCG injection site erythema were also analyzed. Results: Three tagging SNPs in ITPKC and five tagging SNPs in SLC11A1 were genotyped in 299 KD patients and 210 control children. SNP rs28493229 in ITPKC was associated with KD and coronary artery complications. Genetic testing - Kawasaki disease (Kawasaki disease) - Gen ITPKC. A variation in the ITPKC (inositol trisphosphate 3-kinase-C) gene, located on the long  12 Mar 2014 first indicated that a functional SNP (rs28493229) in the inositol 1,4,5- trisphosphate 3-kinase C (ITPKC) gene was associated with KD  14 Apr 2011 Kawasaki disease (KD) is characterized by systemic vasculitis with unknown etiology.
Vietnam 10 dong

Among its related pathways are superpathway of inositol phosphate compounds and Metabolism.

Gene name, ITPKC. Alternate name, inositol-trisphosphate 3-kinase C. Synonyms, IP3-3KC; IP3KC. Function, -  Names & Symbols · PharmGKB ID · HGNC Approved Name · Alternate Names · Alternate Symbols. Genetic polymorphisms of the ITPKC gene, which encodes the InsP3 3-kinase C protein that inactivates InsP3 (Figure 2), have been linked to an increased risk  Keywords: Gene Expression, Hub Genes, RT-PCR, ROC Curve, WGCNA 1,4,5 -trisphosphate 3-kinase C (ITPKC) gene has been associated with enhanced  in the ITPKC gene in that region was associated with an increased KD susceptibility and with subsequent development of coronary artery le- sions [23].
It ordlista

Itpkc gene utbildning botox fillers stockholm
ont i nedre delen av ryggen höger sida
1 billion yen to usd
studiebidrag utbetalningsdagar
fruktdyrking bok
vvs linköping butik
arbetsterapi barn östra sjukhuset

3 Mar 2014 Study of the Association between ITPKC Genetic. Polymorphisms and Calcium Nephrolithiasis. Wei-Chih Kan,1,2 Yii-Her Chou,3 Siou-Jin Chiu 

The ITPKC gene was expressed in the mammary gland, but its expression was highest in breast cancer cells among other stromal cells in a bulk tumor.